Open Access

Polymorphic variants in exon 8 at the 3' UTR of the HLA-G gene are associated with septic shock in critically ill patients

  • Pietra Graebin1, 2,
  • Tiago D Veit1,
  • Clarice S Alho2,
  • Fernando S Dias3 and
  • José AB Chies1Email author
Critical Care201216:R211

Received: 7 May 2012

Accepted: 9 October 2012

Published: 29 October 2012



Critically ill patients are characterized as individuals hospitalized in the Intensive Care Unit (ICU) and can evolve to sepsis, septic shock or even death. Among others, genetic factors can influence the outcome of critically ill patients. HLA-G is a non-classical class Ib molecule that has limited protein variability, presenting seven isoforms generated by alternative splicing, and presents immunomodulatory properties. Polymorphisms at the 3'UTR are thought to influence HLA-G gene expression. It was previously observed that increased sHLA-G5 levels were predictive of survival among septic shock patients. We assessed the frequencies of 7 polymorphisms in exon 8 at the 3' UTR of HLA-G and associated these variants with different clinical outcomes in critically ill patients.


Exon 8 at the 3' UTR of the HLA-G gene from 638 critically ill subjects was amplified by PCR and sequenced. Genotypes were identified using FinchTV software v.1.4.0 and the most probable haplotype constitution of each sample was determined by PHASE software v.2.1. Haplotype frequencies, linkage disequilibrium, heterozygosity test and Hardy-Weinberg Equilibrium were estimated using ARLEQUIN software v.3.5.


Among all critically ill patients, an association between carriers of the +2960IN_+3142 G_+3187A haplotype and septic shock (P = 0.047) was observed. Septic patients who carried the +2960IN_+3142G_+3187A haplotype presented an increased risk for septic shock (P = 0.031).


The present study showed, for the first time, an association between polymorphisms in exon 8 at the 3 'UTR of HLA-G gene and outcomes of critically ill patients. These results may be important for understanding the mechanisms involved in evolution to septic shock in critically ill patients.


Critically ill patients are individuals hospitalized in the ICU, who can evolve to sepsis, septic shock, death, or survival [1]. Massive resources have been invested in sepsis control, either in public or private sectors, and sepsis is the major cause of death in Brazilian ICUs according to ILAS (Instituto Latino Americano de Sepse) [2]. Several factors influence the outcome of critically ill patients, including different degrees of inflammatory response to infections and genetic factors [3]. Human leucocyte antigen G (HLA-G) is a non-classical class Ib molecule that differs from classical class I molecules mainly due to limited protein variability, expression of seven isoforms (HLA-G1-4 membrane-bound forms and HLA-G5-7 soluble forms) generated by alternative splicing [4], and by its immunomodulatory properties [5]. HLA-G molecules, through binding to specific receptors (ILT-2 (LILRB1 and CD85j)) [6], (LT-4 (LILRB2 and CD85d)) [7] and KIR2DL4 (CD158d) [8]) can inhibit the cytotoxic activity, and mediate apoptosis of CD8+ T cells and natural killer (NK) cells, the proliferative response of CD4+ T cells, and target them for an immunosuppressive profile and the differentiation of antigen-presenting cells and B cells [9], as well as being involved in Th1/Th2 balance [10, 11].

In non-pathological conditions, HLA-G expression is highly tissue-specific and can be detected in trophoblast cells, medullary cells of the thymus, cornea, pancreatic islets and adult endothelial cell precursors [12]. The HLA-G molecule has been implicated in several conditions, such as pregnancy [1315], acceptance of allografts [1618], evasion of tumors [1924] or viral infections [2532] from immune response, inflammatory autoimmune diseases [3347], and spontaneous intracerebral hemorrhage [48]. So far, only one study has investigated HLA-G expression in critically ill patients with septic shock, observing that increased HLA-G5 levels were predictive of survival among these patients [49].

The HLA-G gene is located in the HLA complex at the 6p21.3 chromosome region [50, 51]. HLA-G gene expression is regulated by several factors which are not yet completely elucidated, and both its long promoter region, and its 3' untranslated region (UTR) are supposed to play important roles in this process. Of note, the 3' UTR contains eight polymorphisms, most of which are localized at putative miRNA binding sites [52, 53], and three of them were previously associated with differential expression levels of HLA-G: a 14 bp insertion/deletion at position +2960 (rs1704), which is also associated with alternative splicing [54]; a C/G SNP at +3142 (rs1063320), which is located within an miRNA target site and has been shown to differentially affect miRNA binding [52, 53, 55]; and an A/G SNP at +3187 (rs9380142) that is found 4-bp upstream, an AUUUA motif which has been recognized as an (AU)-rich motif sequence that mediates mRNA degradation [56]. The 14 bp insertion has been repeatedly associated with lower levels of the molecule in different studies [37, 5760]. It is noteworthy that this variant is almost always accompanied by +3142G and +3187A alleles, both previously associated with low mRNA availability, indicating that the lower mRNA production associated with 14-bp insertion might be a consequence of the combined presence of these polymorphisms [61].

In the present study, we assessed the frequencies of the haplotype composed by the 14 bp insertion, the +3142G and the +3187G SNPs and, additionally, the allelic and genotypic of the above-mentioned polymorphisms and four other 3'UTR HLA-G SNPs: +3003C>T (rs1707), +3010C>G (rs1710), +3027A>C (rs17179101) and +3035C>T (rs17179108), and sought to associate these variants with different clinical outcomes in critically ill patients.

Materials and methods


Blood samples were obtained from 638 ICU patients from Hospital São Lucas of Pontifícia Universidade Católica do Rio Grande do Sul (PUCRS), located in Porto Alegre, Rio Grande do Sul, the southernmost state of Brazil, between 2004 and 2010. Definition of sepsis and septic shock followed the American College of Chest Physicians/Society of Critical Care Medicine Consensus Conference Committee criteria [62]. Sepsis is defined as the occurrence of systemic inflammatory response syndrome (SIRS) caused by the presence of infection or clinical evidence of infection. SIRS is manifested by two or more of the following symptoms: fever (temperature > 38.0°C) or hypothermia (temperature < 35.5°C), tachycardia (> 90 beats/minute), tachypnea (> 20 breaths/minute), leukocytosis or leukopenia (white blood cell count > 12.000 or < 4.000 cells/µl). Septic shock is defined as the presence of SIRS, documented infection or positive blood culture or organ dysfunction, hypoperfusion abnormality or hypotension. The definition of hypotension is systolic blood pressure < 90 mm Hg or a reduction in systolic blood pressure of 40 mm Hg.

The following exclusion criteria were applied for this study: 1 HIV-positive patients, 2) pregnancy, and 3) patients receiving immunosuppressive therapy. Also, patients readmitted to ICU from whom data were previously collected were excluded. Social and demographic data (age, sex, length of stay in ICU and in hospital) and clinical data (dysfunction and failure of six organ systems during the first week of ICU admission (Sequential Organ Failure Assessment, SOFA score), and physiological variables on the day of ICU admission (Acute Physiology and Chronic Health Evaluation, APACHE II score) were obtained from all patients, in addition to the occurrence of sepsis, septic shock and death.

The protocol of the study was approved by the PUCRS Ethics Committee (CEP-11/05593) and all patients or their surrogates gave written informed consent before blood withdrawal.

3' UTR polymorphisms evaluation

Genomic DNA was extracted according to Lahiri and Nurnberger (1991) [63]. Exon 8 at the 3' UTR of the HLA-G gene of each sample was amplified by PCR (primers HLA-G8F: 5' TGTGAAACAGCTGCCCTGTGT3' and HLA-G8R: 5'GTCTTCCATTTATTTTGTCTCT 3') [61]. Amplification was performed in a final volume of 25 µl containing 0.2 mM each of dNTP; 1.5 mM MgCl2; 10 pmol/µl of each primer; 1 unit of Taq Platinum High Fidelity in 1X PCR-specific buffer (Invitrogen-Life Technologies, São Paulo, Brazil) and 10 to 100 ng of genomic DNA. The initial denaturation cycle was carried out at 94ºC for 5 minutes; followed by 35 cycles at 95ºC for 45 s; 56ºC for 45 s; 72ºC for 1 minute and by a final extension step at 72ºC for 7 minutes. The amplification product was quantified (10 to 50 ng/µl) by Low Mass (Invitogen-Life Technologies, São Paulo, Brazil) in 1% agarose gel. Fragments with 14 bp insertion presented 361 pb. PCR products were directly sequenced using the primer HLA-G8R: 5'GTCTTCCATTTATTTTGTCTCT 3' in an ABI 3730 XL DNA Sequencer according to the manufacturer's manual. Genotyping was performed by interpretation of chromatogram peaks by sequencing FinchTV software version 1.4.0.

The PHASE software version 2.1 [64, 65] was used to determinate the most probable haplotype constitution of each sample. Six independent runs with different seed values provided the same results by PHASE methods. The lowest probability value was between 0.9650 and 1.0000. Haplotype frequencies, linkage disequilibrium (LD), heterozygosity test and Hardy-Weinberg Equilibrium (HWE) were defined using ARLEQUIN software version 3.5 [66].

Statistical analysis

Statistical calculations were performed using statistical package SPSS 18 (SPSS 18.0 for Windows, Chicago, Illinois, USA). Unless otherwise stated, continuous variable results were expressed as mean ± SD, and categorical variables as frequencies and percents. For the categorical data we used Pearson chi square test. The Bonferroni correction was applied when P values were significant. All reported P-values are two-tailed and considered statistically significant when 0.05 or less.

Results and discussion

The median age among the 638 critically ill patients (53.0% male and 47.0% female) was 57 years (13min/97max). Of the 638 patients, 73.5% (n = 469) developed sepsis, 51.6% (n = 329) progressed to septic shock, 32.9% (n = 210) died in the ICU; the mortality rate in the ICU + hospital was 45.7% (n = 290). Other clinical details are displayed in Table 1.
Table 1

Clinical and demographic data of critically ill patients


Values in critically ill patients (n = 683)

Age, years

57 (13/97)

Male, n (%)

338 (53.0)

APACHE II score, mean (SD)

19.32 (7.73)

SOFA scores, median (min/max)



6 (0/18)


6 (0/17)


6 (0/18)


6 (0/22)


5 (0/20)


5 (0/21)


5 (0/24)


5 (0/19)


5 (0/16)

Length of stay, days, median (min/max)



13 (0/173)

ICU + hospital

35 (1/242)

With sepsis, n (%)

469 (73.5)

With septic shock, n (%)

329 (51.6)

ICU mortality, n (%)

210 (32.9)

ICU + hospital mortality, n (%)

290 (45.7)

APACHE-II: Acute Physiology and Chronic Health Evaluation II; SOFA: Sequential Organ Failure Assessment; n: number of patients.

Allelic, genotype, haplotype and diplotype frequencies

Table 2 presents allelic and genotypic frequencies of polymorphisms in critically ill patients. These frequencies are in agreement with other studies in Brazilian populations with a similar ethnic background [67, 68]. Therefore, our sample is representative of the population of southern Brazil, which has a major contribution from European ancestry [68, 69].
Table 2

HLA-G 3'UTR allelic and genotypic frequencies among critically ill patients


+2960 INDEL

































































































HWE: Hardy-Weinberg equilibrium.

The heterozygosity test indicated an observed heterozygosity higher than expected at the +2960INDEL, +3010C>G, +3142C>G and +3187A>G polymorphisms (Table 3). These polymorphisms were not in HWE. Castelli et al. (2011) also reported disagreement on HWE for +2960INDEL polymorphism in a Brazilian population. It is interesting that the diversity of the HLA-G locus is eight times higher than the average of the diversity of the human genome [55]. Moreover, among the HLA-G regions, the 3' UTR region shows more diversity than the promoter and the 5' upstream regulatory regions (5'URR) [67].
Table 3

Heterozygosity test































*Polymorphisms with observed heterozygosity values greater than expected.

A strong LD was observed between all polymorphic sites (P < 0.01, data not shown), which is consistent with data available in the literature [61]. According to the PHASE software, there were 22 different inferred haplotypes among critically ill patients. The most frequent haplotypes were UTR-1 (27.90%), UTR-2 (26.65%), UTR-3 (10.42%), UTR-5 (10.03%) and UTR-4 (8.93%) (haplotype nomenclature according to [61]). The two most frequent haplotypes observed among critically ill patients were also the most frequent in populational studies with southern Brazilian healthy populations [61, 67, 68]. Also, we observed 64 different diplotypes, with the DTGCCCG/ITCCCGA (UTR-1/UTR-2) diplotype being the most frequent among critically ill patients (15.8%). Assuming that the Brazilian population is a heterogeneous one [67], this diversity was expected due to its colonization history [68, 69]. Furthermore, it has already been suggested, and our data also support this view, that this region is under balancing selection, in which there is a selection of heterozygotes [55, 67]. The selection of heterozygote could be evolutionarily advantageous, since it could promote a balance between high and low HLA-G expression, according to the biological context.

Polymorphic variants of HLA-G and outcomes of critically ill patients

Possible outcomes considered were sepsis, septic shock, ICU mortality and ICU+hospital mortality among patients with septic shock. The genotypes of each SNP were tested separately for progression to sepsis, septic shock, death in the ICU and death in the ICU + hospital; however no significant differences were observed. Haplotype and diplotype frequencies, when subjected to the same tests, were not associated with the considered outcomes (data not shown).

From all analyzed variants, +2960IN, +3142G and +3187A alleles had already been associated with reduced HLA-G expression [57, 61]. Considering a potential interaction effect and the strong LD observed for these three variants, haplotypes encompassing those variants were determined and the presence/absence of this particular haplotype (+2960IN_+3142G_+3187A) was analyzed in relation to the studied clinical outcomes.

As can be observed in Table 4, among all critically ill patients, carriers of the +2960IN_+3142G_+3187A haplotype were more likely to develop septic shock (P = 0.047). When considering only patients who developed sepsis, carriers of this haplotype were more likely to develop septic shock (odds ratio, OR = 1.62, 95% CI 1.04, 2.50, P = 0.031) (Table 5). When analyzing mortality among patients with septic shock, no significant differences were observed (Table 5).
Table 4

Carriers and noncarriers of the +2960IN_+3142G_+3187A haplotype and clinical features among 683 critically ill patients


Number (%) of carriers of +2960IN_+3142G_+3187A

Number (%) of noncarriers of +2960IN_+3142G_+3187A



436 (68.3)

202 (31.7)


With sepsis

323 (74.1)

146 (72.3)


With septic shock

237 (54.4)

92 (45.5)


ICU mortality

149 (34.2)

61 (30.2)


ICU + hospital mortality

201 (46.1)

89 (44.1)


P-value, Pearson chi-Square test with the Yates correction; *comparison between carriers and noncarriers of the haplotype +2960IN_+3142G_+3187A.

Table 5

Presence/absence of the +2960IN_+3142G_+3187A (IN-G-A) haplotype in relation to progression to septic shock (SS) and mortality after SS among patients with sepsis


With IN-G-An (%)

Without IN-G-An (%)

Odds ratio(95% CI)


With sepsis

323 (68.9)

146 (31.1)



Progression to SS

237 (73.4)

92 (63.0)

1.62 (1.04-2.50)


Without SS

86 (26.6)

54 (37.0)


ICU mortality (among SS patients)

122/237 (51.5)

48/92 (52.2)

0.97 (0.58-1.62)


ICU + hospital mortality (among SS patients)

149/237 (62.9)

61/92 (66.3)

0.86 (0.50-1.47)


P-value, Pearson chi-Square test with the Yates correction; *chi-square test significant (P < 0.05).

Next, we sought to investigate if specific clinical outcomes could be associated with a particular polymorphism among critically ill patients. For each polymorphism, individuals were grouped according to presence/absence of a given allele and tested for association between a particular allele carrier and outcomes (progression to sepsis, septic shock, ICU mortality and ICU+hospital mortality). Among all critically ill patients there were no significant differences for sepsis (Table 6).
Table 6

Presence/absence of each allele of a given polymorphism and sepsis in all critically ill patients



With IN, n (%)

Without IN, n (%)


+ 2960INDEL

Total of ICU patients

440 (69.0)

198 (31.0)



With sepsis

326 (74.1)

143 (72.2)



Without sepsis

114 (25.9)

55 (27.7)




With +3003C, n (%)

Without +3003C n, (%)

P -value


Total of ICU patients

132 (20.7)

506 (79.3)



With sepsis

98 (74.2)

371 (73.3)



Without sepsis

34 (25.8)

135 (26.7)




With +3010C n, (%)

Without +3010C, n (%)

P -value


Total of ICU patients

505 (79.2)

133 (20.8)



With sepsis

373 (73.9)

96 (72.2)



Without sepsis

132 (26.1)

37 (27.8)




With +3027A, n (%)

Without +3027A, n (%)

P -value


Total of ICU patients

43 (6.7)

595 (93.3)



With sepsis

36 (83.7)

433 (72.8)



Without sepsis

7 (16.3)

162 (27.2)




With +3035T, n (%)

Without +3035T, n (%)

P -value


Total of ICU patients

170 (26.6)

468 (73.4)



With sepsis

125 (73.5)

344 (73.5)



Without sepsis

45 (26.5)

124 (26.5)




With +3142G, n (%)

Without +3142G, n (%)

P -value


Total of ICU patients

523 (82.0)

115 (18.0)



With sepsis

391 (75.0)

78 (67.8)



Without sepsis

132 (25.0)

37 (32.2)




With +3187A, n (%)

Without +3187A, n (%)

P -value


Total of ICU patients

607 (95.1)

31 (4.9)



With sepsis

447 (73.6)

22 (71.0)



Without sepsis

160 (26.4)

9 (29.0)


P-value, chi square test; *low values of P.

Among patients who developed sepsis, +2960IN allele carriers presented a higher frequency among patients who progressed to septic shock (P = 0.046), although this finding was not statistically significant after Bonferroni correction for multiple comparisons (Table 7). Among patients who developed septic shock, no significant differences in mortality rate were associated with presence/absence of a given allele (Table 7).
Table 7

Progression to septic shock (SS) and mortality after septic shock among patients with sepsis



With IN, n (%)

Without IN, n (%)


p corr


With sepsis

363 (74.4)

153 (72.9)




Progression to SS

266/363 (73.3)

98/153 (64.1)




ICU mortality

135/266 (50.8)

51/98 (52.0)




ICU + hospital mortality

162/266 (60.9)

65/98 (66.3)





With +3003C, n (%)

Without +3003C, n (%)

P -value



With sepsis

98 (20.9)

371 (79.1)



Progression to SS

71/98 (72.4)

258/371 (69.5)




ICU mortality

44/71 (62.0)

126/258 (48.8)




ICU + hospital mortality

50/71 (70.4)

160/258 (62.3)





With +3010C, n (%)

Without +3010C, n (%)

P -value



With sepsis

373 (79.5)

96 (20.5)




Progression to SS

267/373 (71.6)

62/96 (64.6)




ICU mortality

135/267 (50.6)

35/62 (56.5)




ICU + hospital mortality

166/267 (62.2)

44/62 (71.0)





With +3027A, n (%)

Without +3027A, n (%)

P -value


+3027 A>C

With sepsis

36 (7.7)

433 (92.3)




Progression to SS

25/36 (69.4)

304/433 (70.0)




ICU mortality

15/25 (60.0)

155/304 (51.0)




ICU + hospital mortality

17/25 (68.0)

193/304 (63.5)





With +3035T, n (%)

Without +3035T, n (%)

P -value



With sepsis

125 (26.7)

344 (73.3)




Progression to SS

96/125 (76.8)

233/344 (67.7)




ICU mortality

51/96 (53.1)

119/233 (51.1)




ICU + hospital mortality

63/96 (65.6)

147/233 (63.1)





With +3142G, n (%)

Without +3142G, n (%)

P -value



With sepsis

431 (83.5)

85 (16.5)




Progression to SS

309/431 (71.7)

55/85 (64.7)




ICU mortality

157/309 (50.8)

29/55 (52.7)




ICU + hospital mortality

188/309 (60.8)

39/55 (70.9)





With +3187ª, n (%)

Without +3187ª, n (%)

P -value



With sepsis

447 (95.3)

22 (4.7)




Progression to SS

316/447 (70.7)

13/22 (59.1)




ICU mortality

162/316 (51.3)

8/13 (61.5)




ICU + hospital mortality

200/316 (63.3)

10/13 (76.9)



P-value, chi square test; Pcorr, P-value after Bonferroni correction (n = 9).

The present study observed an association between haplotypes in exon 8 at 3' UTR of the HLA-G gene and outcomes in critically ill patients. These results may be important for understanding the mechanisms involved on evolution to septic shock in critically ill patients. So far, there has only been one study of HLA-G in critically ill patients, in which a higher concentration of soluble HLA-G5 was observed, and was predictive of survival after progression to septic shock [49]. Our results suggest that critically ill patients who are carriers of +2960IN_+3142G_+3187A haplotype, associated with a reduced HLA-G expression, are more likely to develop septic shock. Therefore, our results reinforce the idea that decreased production of HLA-G in ICU patients could have a negative impact on patient outcome.


The present study shows for the first time an association between the +2960IN_3142G_3187A haplotype and septic shock among critically ill patients. Given the immunomodulatory properties of HLA-G, we can propose an important role for HLA-G in the mechanisms that define outcomes in critically ill patients.

Opportunely, it should be interesting to analyze other parameters to confirm this association, such as Il-10 and glucocorticoids levels, and cytokine profile in critically ill patients. All these results will provide insights into the understanding of critical illness.

Key message

  • Critically ill patients and critically ill patients who evolve to sepsis carriers of the +2960IN_+3142G_+3187A haplotype, are more likely to develop septic shock.



Acute Physiology and Chronic Health Evaluation


base pair


human leukocyte antigen G


Hardy-Weinberg equilibrium


Instituto Latino Americano de Sepse


linkage disequilibrium


polymerase chain reaction


Pontifícia Universidade Católica do Rio Grande do Sul


Sequential Organ Failure Assessment


single nucleotide polymorphism


systemic inflammatory response syndrome

3' UTR: 

untranslated region 3'.



This work was supported by the Fundação de Amparo à Pesquisa do Estado do Rio Grande do Sul (FAPERGS) grant 10/1516-6, Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) grants 135450/2009-8, 479438/2009-9 and 160530/2011-3 and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES).

Authors’ Affiliations

Laboratory of Immunogenetics of Federal, University of Rio Grande do Sul - 9500
Laboratory of Human and Molecular Genetics of Pontifical Catholic, University of Rio Grande do Sul
São Lucas Hospital, Pontifical Catholic University of Rio Grande do Sul,


  1. Vincent JL: Sepsis: The magnitude of the problem. In The Sepsis Text 2002. Kluwer Academic Publisher, Dordrecht, the Netherlands; 2002.View ArticleGoogle Scholar
  2. Latin American Sepsis Institute[]
  3. Holmes CL: Genetic Polymorphisms in Sepsis and Septic Shock: Role in Prognosis and Potential for Therapy. Chest 2003, 124: 1103-1115. 10.1378/chest.124.3.1103View ArticlePubMedGoogle Scholar
  4. Donadi EA, Castelli EC, Arnaiz-Villena A, Roger M, Rey D, Moreau P: Implications of the polymorphism of HLA-G on its function, regulation, evolution and disease association. Cell Mol Life Sci 2011, 68: 369-395. 10.1007/s00018-010-0580-7PubMed CentralView ArticlePubMedGoogle Scholar
  5. Carosella ED, Dausset J, Rouas-Freiss N: Immunotolerant functions of HLA-G. Cell Mol Life Sci 1999, 55: 327-333. 10.1007/s000180050295View ArticlePubMedGoogle Scholar
  6. Gonen-Gross T, Goldman-Wohl D, Huppertz B, Lankry D, Greenfield C, Natanson-Yaron S, Hamani Y, Gilad R, Yagel S, Mandelboim O: Inhibitory NK receptor recognition of HLA-G: regulation by contact residues and by cell specific expression at the fetal-maternal interface. PLoS One 2010, 5: e8941. 10.1371/journal.pone.0008941PubMed CentralView ArticlePubMedGoogle Scholar
  7. Borges L, Cosman D: LIRs/ILTs/MIRs, inhibitory and stimulatory Ig-superfamily receptors expressed in myeloid and lymphoid cells. Cytokine Growth Factor Rev 2000, 11: 209-217. 10.1016/S1359-6101(00)00007-1View ArticlePubMedGoogle Scholar
  8. Hsu KC, Chida S, Geraghty DE, Dupont B: The killer cell immunoglobulin-like receptor (KIR) genomic region: gene-order, haplotypes and allelic polymorphism. Immunol Rev 2002, 190: 40-52. 10.1034/j.1600-065X.2002.19004.xView ArticlePubMedGoogle Scholar
  9. Carosella ED, HoWangYin K-Y, Favier B, LeMaoult J: HLA-G-dependent suppressor cells: Diverse by nature, function, and significance. Hum Immunol 2008, 69: 700-707. 10.1016/j.humimm.2008.08.280View ArticlePubMedGoogle Scholar
  10. Kapasi K, Albert SE, Yie S, Zavazava N, Librach CL: HLA-G has a concentration-dependent effect on the generation of an allo-CTL response. Immunology 2000, 101: 191-200. 10.1046/j.1365-2567.2000.00109.xPubMed CentralView ArticlePubMedGoogle Scholar
  11. Kanai T, Fujii T, Kozuma S, Yamashita T, Miki A, Kikuchi A, Taketani Y: Soluble HLA-G influences the release of cytokines from allogeneic peripheral blood mononuclear cells in culture. Mol Hum Reprod 2001, 7: 195-200. 10.1093/molehr/7.2.195View ArticlePubMedGoogle Scholar
  12. Veit TD, Vianna P, Chies JAB: HLA-G - from fetal tolerance to a regulatory molecule in inflammatory diseases. Curr Immunol Rev 2010, 6: 1-15.Google Scholar
  13. Ober C, Aldrich CL, Chervoneva I, Billstrand C, Rahimov F, Gray HL, Hyslop T: Variation in the HLA-G promoter region influences miscarriage rates. Am J Hum Genet 2003, 72: 1425-1435. 10.1086/375501PubMed CentralView ArticlePubMedGoogle Scholar
  14. Vianna P, Dalmáz CA, Veit TD, Tedoldi C, Roisenberg I, Chies JAB: Immunogenetics of pregnancy: role of a 14-bp deletion in the maternal HLA-G gene in primiparous pre-eclamptic Brazilian women. Hum Immunol 2007, 68: 668-674. 10.1016/j.humimm.2007.05.006View ArticlePubMedGoogle Scholar
  15. Gonzalez A, Alegre E, Torres MI, Díaz-Lagares A, Lorite P, Palomeque T, Arroyo A: Evaluation of HLA-G5 plasmatic levels during pregnancy and relationship with the 14-bp polymorphism. Am J Reprod Immunol 2010, 64: 367-374.PubMedGoogle Scholar
  16. Deschaseaux F, Delgado D, Pistoia V, Giuliani M, Morandi F, Durrbach A: HLA-G in organ transplantation: towards clinical applications. Cell Mol Life Sci 2011, 68: 397-404. 10.1007/s00018-010-0581-6View ArticlePubMedGoogle Scholar
  17. Lila N, Amrein C, Guillemain R, Chevalier P, Fabiani J, Carpentier A: Soluble Human Leukocyte Antigen-G: A New Strategy for Monitoring Acute and Chronic Rejections After Heart Transplantation. J Heart Lung Transplant 2007, 26: 421-422. 10.1016/j.healun.2007.01.001View ArticlePubMedGoogle Scholar
  18. Naji A, Le Rond S, Durrbach A, Krawice-Radanne I, Creput C, Daouya M, Caumartin J, LeMaoult J, Carosella ED, Rouas-Freiss N: CD3+CD4low and CD3+CD8low are induced by HLA-G: novel human peripheral blood suppressor T-cell subsets involved in transplant acceptance. Blood 2007, 110: 3936-3948. 10.1182/blood-2007-04-083139View ArticlePubMedGoogle Scholar
  19. Ugurel S, Rebmann V, Ferrone S, Tilgen W, Grosse-Wilde H, Reinhold U: Soluble human leukocyte antigen-G serum level is elevated in melanoma patients and is further increased by interferon-alpha immunotherapy. Cancer 2001, 92: 369-376. 10.1002/1097-0142(20010715)92:2<369::AID-CNCR1332>3.0.CO;2-UView ArticlePubMedGoogle Scholar
  20. Amiot L, Le Friec G, Sebti Y, Drénou B, Pangault C, Guilloux V, Leleu X, Bernard M, Facon T, Fauchet R: HLA-G and lymphoproliferative disorders. Semin Cancer Biol 2003, 13: 379-385. 10.1016/S1044-579X(03)00029-4View ArticlePubMedGoogle Scholar
  21. Leleu X: Total Soluble HLA Class I and Soluble HLA-G in Multiple Myeloma and Monoclonal Gammopathy of Undetermined Significance. Clin Cancer Res 2005, 11: 7297-7303. 10.1158/1078-0432.CCR-05-0456View ArticlePubMedGoogle Scholar
  22. Gros F, Sebti Y, de Guibert S, Branger B, Bernard M, Fauchet R, Amiot L: Soluble HLA-G molecules increase during acute leukemia, especially in subtypes affecting monocytic and lymphoid lineages. Neoplasia 2006, 8: 223-230. 10.1593/neo.05703PubMed CentralView ArticlePubMedGoogle Scholar
  23. Ye S-R, Yang H, Li K, Dong D-D, Lin X-M, Yie S-M: Human leukocyte antigen G expression: as a significant prognostic indicator for patients with colorectal cancer. Mod Pathol 2007, 20: 375-383. 10.1038/modpathol.3800751View ArticlePubMedGoogle Scholar
  24. Schütt P, Schütt B, Switala M, Bauer S, Stamatis G, Opalka B, Eberhardt W, Schuler M, Horn Pa, Rebmann V: Prognostic relevance of soluble human leukocyte antigen-G and total human leukocyte antigen class I molecules in lung cancer patients. Hum Immunol 2010, 71: 489-495. 10.1016/j.humimm.2010.02.015View ArticlePubMedGoogle Scholar
  25. Matte C, Lajoie J, Lacaille J, Zijenah LS, Ward BJ, Roger M: Functionally active HLA-G polymorphisms are associated with the risk of heterosexual HIV-1 infection in African women. Aids 2004, 18: 427-431. 10.1097/00002030-200402200-00008View ArticlePubMedGoogle Scholar
  26. Aikhionbare FO, Kumaresan K, Shamsa F, Bond VC: HLA-G DNA sequence variants and risk of perinatal HIV-1 transmission. AIDS Res Ther 2006, 3: 28. 10.1186/1742-6405-3-28PubMed CentralView ArticlePubMedGoogle Scholar
  27. Lajoie J, Hargrove J, Zijenah LS, Humphrey JH, Ward BJ, Roger M: Genetic variants in nonclassical major histocompatibility complex class I human leukocyte antigen (HLA)-E and HLA-G molecules are associated with susceptibility to heterosexual acquisition of HIV-1. J Infect Dis 2006, 193: 298-301. 10.1086/498877View ArticlePubMedGoogle Scholar
  28. Cordero EAA, Veit TD, da Silva MAL, Callegari-Jacques SM, Silla LMDR, Chies JAB: HLA-G polymorphism influences the susceptibility to HCV infection in sickle cell disease patients. Tissue Antigens 2009, 74: 308-313. 10.1111/j.1399-0039.2009.01331.xView ArticlePubMedGoogle Scholar
  29. Fabris A, Catamo E, Segat L, Morgutti M, Arraes LC, de Lima-Filho JL, Crovella S: Association between HLA-G 3'UTR 14-bp polymorphism and HIV vertical transmission in Brazilian children. AIDS 2009, 23: 177-182. 10.1097/QAD.0b013e32832027bfView ArticlePubMedGoogle Scholar
  30. Chen H-X, Chen B-G, Shi W-W, Zhen R, Xu D-P, Lin A, Yan W-H: Induction of cell surface human leukocyte antigen-G expression in pandemic H1N1 2009 and seasonal H1N1 influenza virus-infected patients. Hum Immunol 2011, 72: 159-165. 10.1016/j.humimm.2010.11.009View ArticlePubMedGoogle Scholar
  31. Yan W-H, Lin A, Chen B-G, Chen S-Y: Induction of both membrane-bound and soluble HLA-G expression in active human cytomegalovirus infection. J Infect Dis 2009, 200: 820-826. 10.1086/604733View ArticlePubMedGoogle Scholar
  32. Souto FJD, Crispim JCO, Ferreira SC, da Silva ASM, Bassi CL, Soares CP, Zucoloto S, Rouas-Freiss N, Moreau P, Martinelli AL, Donadi EA: Liver HLA-G expression is associated with multiple clinical and histopathological forms of chronic hepatitis B virus infection. J Viral Hepat 2011, 18: 102-105. 10.1111/j.1365-2893.2010.01286.xView ArticlePubMedGoogle Scholar
  33. Gazit E, Slomov Y, Goldberg I, Brenner S, Loewenthal R: HLA-G is associated with pemphigus vulgaris in jewish patients. Hum Immunol 2004, 65: 39-46. 10.1016/j.humimm.2003.09.019View ArticlePubMedGoogle Scholar
  34. Nicolae D, Cox NJ, Lester LA, Schneider D, Tan Z, Billstrand C, Kuldanek S, Donfack J, Kogut P, Patel NM, Goodenbour J, Howard T, Wolf R, Koppelman GH, White SR, Parry R, Postma DS, Meyers D, Bleecker ER, Hunt JS, Solway J, Ober C: Fine mapping and positional candidate studies identify HLA-G as an asthma susceptibility gene on chromosome 6p21. Am J Hum Genet 2005, 76: 349-357. 10.1086/427763PubMed CentralView ArticlePubMedGoogle Scholar
  35. Mitsdoerffer M, Schreiner B, Kieseier BC, Neuhaus O, Dichgans J, Hartung H-P, Weller M, Wiendl H: Monocyte-derived HLA-G acts as a strong inhibitor of autologous CD4 T cell activation and is upregulated by interferon-beta in vitro and in vivo: rationale for the therapy of multiple sclerosis. J Neuroimmunol 2005, 159: 155-164. 10.1016/j.jneuroim.2004.09.016View ArticlePubMedGoogle Scholar
  36. Verbruggen La, Rebmann V, Demanet C, De Cock S, Grosse-Wilde H: Soluble HLA-G in rheumatoid arthritis. Hum Immunol 2006, 67: 561-567. 10.1016/j.humimm.2006.03.023View ArticlePubMedGoogle Scholar
  37. Rizzo R, Hviid TV, Govoni M, Padovan M, Rubini M, Melchiorri L, Stignani M, Carturan S, Grappa MT, Fotinidi M, Ferretti S, Voss A, Laustrup H, Junker P, Trotta F, Baricordi OR: HLA-G genotype and HLA-G expression in systemic lupus erythematosus: HLA-G as a putative susceptibility gene in systemic lupus erythematosus. Tissue antigens 2008, 71: 520-529. 10.1111/j.1399-0039.2008.01037.xView ArticlePubMedGoogle Scholar
  38. Torres MI, López-Casado MA, Luque J, Peña J, Ríos A: New advances in coeliac disease: serum and intestinal expression of HLA-G. Int Immunol 2006, 18: 713-718.View ArticlePubMedGoogle Scholar
  39. Glas J, Török HP, Tonenchi L, Wetzke M, Beynon V, Teshome MY, Cotofana S, Schiemann U, Griga T, Klein W, Epplen JT, Folwaczny C, Folwaczny M, Mussack T, Weiss EH: The 14-bp deletion polymorphism in the HLA-G gene displays significant differences between ulcerative colitis and Crohn's disease and is associated with ileocecal resection in Crohn's disease. Int Immunol 2007, 19: 621-626. 10.1093/intimm/dxm027View ArticlePubMedGoogle Scholar
  40. Park KS, Park JS, Nam JH, Bang D, Sohn S, Lee ES: HLA-E*0101 and HLA-G*010101 reduce the risk of Behcet's disease. Tissue Antigens 2007, 69: 139-144. 10.1111/j.1399-0039.2006.00742.xView ArticlePubMedGoogle Scholar
  41. Lin A, Yan WH, Xu HH, Tang LJ, Chen XF, Zhu M, Zhou MY: 14 bp deletion polymorphism in the HLA-G gene is a risk factor for idiopathic dilated cardiomyopathy in a Chinese Han population. Tissue Antigens 2007, 70: 427-431. 10.1111/j.1399-0039.2007.00926.xView ArticlePubMedGoogle Scholar
  42. Rosado S, Perez-Chacon G, Mellor-Pita S, Sanchez-Vegazo I, Bellas-Menendez C, Citores MJ, Losada-Fernandez I, Martin-Donaire T, Rebolleda N, Perez-Aciego P: Expression of human leukocyte antigen-G in systemic lupus erythematosus. Hum Immunol 2008, 69: 9-15. 10.1016/j.humimm.2007.11.001View ArticlePubMedGoogle Scholar
  43. Veit TD, Cordero EAA, Mucenic T, Monticielo OA, Brenol JCT, Xavier RM, Delgado-Cañedo A, Chies JAB: Association of the HLA-G 14 bp polymorphism with systemic lupus erythematosus. Lupus 2009, 18: 424-430. 10.1177/0961203308098187View ArticlePubMedGoogle Scholar
  44. Ciprandi G, Contini P, Murdaca G, DeAmici M, Gallina AM, Puppo F: Soluble serum HLA-G and HLA-A, -B, -C molecules in patients with seasonal allergic rhinitis exposed to pollens. Int Immunopharmacol 2009, 9: 1058-1062. 10.1016/j.intimp.2009.04.014View ArticlePubMedGoogle Scholar
  45. Wastowski IJ, Sampaio-Barros PD, Amstalden EMI, Palomino GM, Marques-Neto JF, Crispim JCO, Biral AC, Rassi DM, Carosella ED, Moreau P, Donadi EA: HLA-G expression in the skin of patients with systemic sclerosis. J Rheumatol 2009, 36: 1230-1234. 10.3899/jrheum.080552View ArticlePubMedGoogle Scholar
  46. Forrest CM, Mackay GM, Stoy N, Spiden SL, Taylor R, Stone TW, Darlington LG: Blood levels of kynurenines, interleukin-23 and soluble human leucocyte antigen-G at different stages of Huntington's disease. J Neurochem 2010, 112: 112-122. 10.1111/j.1471-4159.2009.06442.xView ArticlePubMedGoogle Scholar
  47. Cardili RN, Alves TG, Freitas JCOC, Soares CP, Mendes-Junior CT, Soares EG, Donadi EA, Silva-Souza C: Expression of human leucocyte antigen-G primarily targets affected skin of patients with psoriasis. Br J Dermatol 2010, 163: 769-775. 10.1111/j.1365-2133.2010.09917.xView ArticlePubMedGoogle Scholar
  48. Fainardi E, Rizzo R, Lupato A, Ramponi V, Santis GD, Garofano F, Stignani M, Tamborino C, Castellazzi M, Casetta I, Baricordi OR: Timing of serum soluble HLA-G levels in acute and subacute phases after spontaneous intracerebral hemorrhage. Acta Neurochir Suppl 2010, 106: 141-145. 10.1007/978-3-211-98811-4_25View ArticlePubMedGoogle Scholar
  49. Monneret G, Voirin N, Krawice-Radanne I, Bohé J, Lepape A, Rouas-Freiss N, Carosella ED: Soluble human leukocyte antigen-G5 in septic shock: marked and persisting elevation as a predictor of survival. Crit Care Med 2007, 35: 1942-1947. 10.1097/01.CCM.0000277039.84372.1CView ArticlePubMedGoogle Scholar
  50. Geraghty DE, Koller BH, Orr HT: A human major histocompatibility complex class I gene that encodes a protein with a shortened cytoplasmic segment. Proc Natl Acad Sci USA 1987, 84: 9145-9149. 10.1073/pnas.84.24.9145PubMed CentralView ArticlePubMedGoogle Scholar
  51. HLA-G major histocompatibility complex, class I, G [Homo sapiens][]
  52. Tan Z, Randall G, Fan J, Camoretti-Mercado B, Brockman-Schneider R, Pan L, Solway J, Gern JE, Lemanske RF, Nicolae D, Ober C: Allele-specific targeting of microRNAs to HLA-G and risk of asthma. Am J Hum Genet 2007, 81: 829-834. 10.1086/521200PubMed CentralView ArticlePubMedGoogle Scholar
  53. Castelli EC, Moreau P, Oya e Chiromatzo A, Mendes-Junior CT, Veiga-Castelli LC, Yaghi L, Giuliatti S, Carosella ED, Donadi EA: In silico analysis of microRNAS targeting the HLA-G 3' untranslated region alleles and haplotypes. Hum Immunol 2009, 70: 1020-1025. 10.1016/j.humimm.2009.07.028View ArticlePubMedGoogle Scholar
  54. Rousseau P, Le Discorde M, Mouillot G, Marcou C, Carosella ED, Moreau P: The 14 pb deletion-insertion polymorphism in the 3'UTR region on the HLA-G gene influences HLA-G mRNA stability. Hum Immunol 2003, 64: 1005-1010. 10.1016/j.humimm.2003.08.347View ArticlePubMedGoogle Scholar
  55. Tan Z, Shon AM, Ober C: Evidence of balancing selection at the HLA-G promoter region. Hum Mol Genet 2005, 14: 3619-3628. 10.1093/hmg/ddi389View ArticlePubMedGoogle Scholar
  56. Yie S-M, Li L-h, Xiao R, Librach CL: A single base-pair mutation in the 3'-untranslated region of HLA-G mRNA is associated with pre-eclampsia. Mol Hum Reprod 2008, 14: 649-653. 10.1093/molehr/gan059View ArticlePubMedGoogle Scholar
  57. Hviid TVF, Hylenius S, Rørbye C, Nielsen LG: HLA-G allelic variants are associated with differences in the HLA-G mRNA isoform profile and HLA-G mRNA levels. Immunogenetics 2003, 55: 63-79.PubMedGoogle Scholar
  58. Hviid TVF, Rizzo R, Christiansen OB, Melchiorri L, Lindhard A, Baricordi OR: HLA-G and IL-10 in serum in relation to HLA-G genotype and polymorphisms. Immunogenetics 2004, 56: 135-141.View ArticlePubMedGoogle Scholar
  59. Rizzo R, Hviid TVF, Stignani M, Balboni A, Grappa MT, Melchiorri L, Baricordi OR: The HLA-G genotype is associated with IL-10 levels in activated PBMCs. Immunogenetics 2005, 57: 172-181. 10.1007/s00251-005-0788-0View ArticlePubMedGoogle Scholar
  60. Rizzo R, Rubini M, Govoni M, Padovan M, Melchiorri L, Stignani M, Carturan S, Ferretti S, Trotta F, Baricordi OR: HLA-G 14-bp polymorphism regulates the methotrexate response in rheumatoid arthritis. Pharmacogenet Genomics 2006, 16: 615-623. 10.1097/01.fpc.0000230115.41828.3aView ArticlePubMedGoogle Scholar
  61. Castelli EC, Mendes-Junior CT, Deghaide NHS, de Albuquerque RS, Muniz YCN, Simões RT, Carosella ED, Moreau P, Donadi EA: The genetic structure of 3'untranslated region of the HLA-G gene: polymorphisms and haplotypes. Genes Immun 2010, 11: 134-141. 10.1038/gene.2009.74View ArticlePubMedGoogle Scholar
  62. Bone R, Balk R, Cerra F, Dellinger R, Fein A, Knaus W, Schein R, Sibbald W: Definitions for sepsis and organ failure and guidelines for the use of innovative therapies in sepsis. The ACCP/SCCM Consensus Conference Committee. American College of Chest Physicians/Society of Critical Care Medicine. Chest 1992, 101: 1644-1655. 10.1378/chest.101.6.1644View ArticlePubMedGoogle Scholar
  63. Lahiri DK, Nurnberger JI: A rapid non-enzymatic method for the preparation of HMW DNA from blood for RFLP studies. Nucleic Acids Res 1991, 19: 5444. 10.1093/nar/19.19.5444PubMed CentralView ArticlePubMedGoogle Scholar
  64. Stephens M, Smith NJ, Donnelly P: A new statistical method for haplotype reconstruction from population data. Am J Hum Genet 2001, 68: 978-989. 10.1086/319501PubMed CentralView ArticlePubMedGoogle Scholar
  65. Stephens M, Scheet P: Accounting for decay of linkage disequilibrium in haplotype inference and missing-data imputation. Am J Hum Genet 2005, 76: 449-462. 10.1086/428594PubMed CentralView ArticlePubMedGoogle Scholar
  66. Excoffier L, Lischer HEL: Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour 2010, 10: 564-567. 10.1111/j.1755-0998.2010.02847.xView ArticlePubMedGoogle Scholar
  67. Castelli EC, Mendes-Junior CT, Veiga-Castelli LC, Roger M, Moreau P, Donadi EA: A Comprehensive Study of Polymorphic Sites along the HLA-G Gene: Implication for Gene Regulation and Evolution. Mol Biol Evol 2011, 28: 3069-2086. 10.1093/molbev/msr138View ArticlePubMedGoogle Scholar
  68. Lucena-Silva N, Monteiro AR, de Albuquerque RS, Gomes RG, Mendes-Junior CT, Castelli EC, Donadi EA: Haplotype frequencies based on eight polymorphic sites at the 3' untranslated region of the HLA-G gene in individuals from two different geographical regions of Brazil. Tissue Antigens 2012, 79: 272-278. 10.1111/j.1399-0039.2012.01842.xView ArticlePubMedGoogle Scholar
  69. Pena SD, Di Pietro G, Fuchshuber-Moraes M, Genro JP, Hutz MH, Kehdy Fde S, Kohlrausch F, Magno LA, Montenegro RC, Moraes MO, de Moraes ME, de Moraes MR, Ojopi EB, Perini JA, Racciopi C, Ribeiro-Dos-Santos AK, Rios-Santos F, Romano-Silva MA, Sortica VA, Suarez-Kurtz G: The genomic ancestry of individuals from different geographical regions of Brazil is more uniform than expected. PloS One 2011, 6: e17063. 10.1371/journal.pone.0017063PubMed CentralView ArticlePubMedGoogle Scholar


© Graebin et al.; licensee BioMed Central Ltd. 2012

This article is published under license to BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.