Skip to main content

Table 2 List of primers used for quantification of mRNA and DNA expression levels by qPCR and RT-qPCR

From: Sepsis is associated with mitochondrial DNA damage and a reduced mitochondrial mass in the kidney of patients with sepsis-AKI

Gene Primer sequence
ND1, ETC complex 1 Forward: TGGCTCCTTTAACCTCTCCA
Reverse: GGTTCGGTTGGTCTCTGCTA
ND4, ETC complex 1 Forward: GGCGGCTATGGTATAATACG
Reverse: GTAGGCAGATGGAGCTTGTT
ND6, ETC complex 1 Forward: TGATTGTTAGCGGTGTGGTC
Reverse: CCTCAATAGCCATCGCTGTA
COX1, ETC complex 4 Forward: CTAACAGACCGCAACCTCAA
Reverse: CCGAAGCCTGGTAGGATAA
Cytochrome b, ETC complex 3 Forward: TTCCTAGCCATGCACTACTC
Reverse: GAAGGTAGCGGATGATTCAG
D-loop, regulative region Forward: AACCTACCCACCCTTAACAG
Reverse: CACTCTTGTGCGGGATATTG
β2M Forward: CTGGGTAGCTCTAAACAATGTATTCA
Reverse: CATGTACTAACAAATGTCTAAAATGGT
  1. ETC electron transport chain