Skip to main content

Table 4 List of primers for quantification of mRNA expression of mitochondrial quality mechanisms, mitochondrial complexes and oxidation pathways by RT-qPCR

From: Sepsis is associated with mitochondrial DNA damage and a reduced mitochondrial mass in the kidney of patients with sepsis-AKI

Gene Primer sequence Process
PINK1 Forward: GACGCTGTTCCTCGTTATGA Mitophagy
Reverse: TCCAGCTCCACAAGGATGTT
PARKIN Forward: GACCCTCAACTTGGCTACTC Mitophagy
Reverse: CTTCGCAGGTGACTTTCCTC
MFN2 Forward: CCGCCACATAGAGGAAGGAC Fusion
Reverse: CGCACAGACACAGGAAGGAG
DRP1 Forward: AAGCTGCTGCCATAGTCCTC Fission
Reverse: ACCACAGCCATGTCAGTGTC
NRF2 Forward: GCTACTAATCAGGCTCAGTC Mitochondrial biogenesis
Reverse: GTAGTCTCAACCAGCTTGTC
TFAM Forward: CATGGACTTCTGCCAGCATA Mitochondrial biogenesis
Reverse: AGAACACCGTGGCTTCTACA
mnSOD Forward: ACGCGGCCTACGTGAACAAC Antioxidant enzyme
Reverse: CAACAGATGCAGCCGTCAGC
OGG1 Forward: GTGTGCGACTGCTGCGACAA mtDNA damage repair (excision of 8-oxoguanine)
Reverse: CTGGATGAGCCGAGGTCCAA
HIF1α Forward: TGAGGGGACAGGAGGATCAG Master regulator of cellular and systemic homeostatic response to hypoxia
Reverse: CACGCGGAGAAGAGAAGGAA
SIRT1 Forward: ATGCTGGCCTAATAGAGTGG Regulates epigenetic gene silencing, biogenese and antioxidant mechanisms
Reverse: TCTGGAACATCAGGCTCATC
NGAL Forward: GGTGAGCACCAACTACAACC Early biomarker of acute kidney injury
Reverse: GCCCAGAGATTTGGAGAAGC
NDUFA1 Forward; ACTGGCTACTGCGTACATCC ETC complex 1 (nDNA)
Reverse: AGATGCGCCTATCTCTTTCC
COX5b Forward: CATTGGCTCCTTCTCCCATA ETC complex 4 (nDNA)
Reverse: CATACCAGGTGGTCCCATTC
B-actin Forward: AGGATGCAGAAGGAGATCAC Housekeeping gene
Reverse: AGTCATAGTCCGCCTAGAAG
  1. mtDNA mitochondrial DNA, ETC electron transport chain, nDNA nuclear DNA