Skip to main content

Table 3 List of primers used for amplification of mitochondrial DNA with long-range PCR and qPCR

From: Sepsis is associated with mitochondrial DNA damage and a reduced mitochondrial mass in the kidney of patients with sepsis-AKI

Primer Primer sequence
Forward long fragment mtDNA (10 kb) TCTAAGCCTCCTTATTCGAGCCGA
Forward Short fragment mtDNA (222 bp) CCCCACAAACCCCATTACTAAACCCA
Reverse primer mtDNA (short and long) TTTCATCATGCGGAGATGTTGGATGG
  1. mtDNA mitochondrial DNA