SNPs | Primers | PCR conditions | Restriction endonucleases |
---|---|---|---|
-1082A/G | F:ACACAAATCCAAGACAACACTACTAAGGCTTCCTTGGGA | 3 minutes at 94°C followed by 35 cycles of 40 seconds at 94°C, 45 seconds at 56°C, 40 seconds at 72°C, then 10 minutes at 72°C | XagI |
 | R:GTGATCAAACAGAGGCACAGACAT |  |  |
-819T/C | F:CACTCTAAGGCTTCCTTGGGA | 3 minutes at 94°C followed by 35 cycles of 40 seconds at 94°C, 45 seconds at 56°C, 40 seconds at 72°C, then 10 minutes at 72°C | Hin1α |
 | R:CCTACCGTCTCTATTTTATAGTGAGCAAACTGAGGCACAGACAT |  |  |
-592 A/C | F:AGCTGAAGAGGTGGAAACATGTG | 3 minutes at 94°C followed by 35 cycles of 40 seconds at 94°C, 45 seconds at 63°C, 40 seconds at 72°C, then 10 minutes at 72°C | Rsa I |
 | R:TGGGTTCTCATTCGCGTGTT |  |  |