Skip to main content

Table 5 Sample sequences of cfDNA from severe sepsis patients

From: Prognostic utility and characterization of cell-free DNA in patients with severe sepsis

Name Sequence Source Chromosome GenBank Accession Number Identity
150-1 AGAGTCTTGGCATCCATGATAAGTGGGGGTGAGCGGAGGGAAAGACCAAGCCCCAGGACAGCACACTGACCATTCCAGGAGCCAGCATGGGTGGCCCACACACATGGAAGAACTACAGCCCAGACAAGCAGGGCCGCACCAACAGAGGTCCTGCAG Homo sapiens Chromosome 5 genomic contig, reference assembly NT_006713.14 100%
150-2 GATCCAGACCCTTTCTTTTTTTTTTTTTTTTTTTTTTTTTTGANACAGAN
NCTTGCTCTGTCGCCAGGCTGGAGTGCAATGGCGCGATCTCAGCTCACTGCAACCTCCGCCCCCCGCCCCCCGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCACGATCC
Homo sapiens Protein kinase C, α (PRKCA) on chromosome 17 NG_012206.1 97%
150-3 CCTGATTTTCCAGGTGCCGTCTGTCACCCCTTTCTTTGACTAGGAAAGGGAACTCCCTGACCCCTTGCGCTTCCTGAGTGAGGCAATGCCTTGCCCTGCTTCGGCTCGCACACGGTGCGTGCACCCACTGACCTGCGCCCACTGTCTGG Homo sapiens Protein kinase, cAMP-dependent, catalytic, β (PRKACB) gene DQ_667174.1 100%
150-5 CGCGGCGAGGGGGGTAAAAAGCCGCGTTGGCAAAAACCGCGGCGGCGGGGAGCAAAAAGCCGCCGCGGTGGGCGCAAAAAGTCGCCGCGGCCAAAAAGCCGTGCCGGTGGCGGCGGCGGCAAAAAGCCGCGGCGTCGGGGGCGGGG Homo sapiens Chromosome 21 genomic contig, reference assembly NT_113952.1 100%
150-6 CCCGTAAAGACCCAGGTCACAGGCCACTGTGGCGGAGGGCAGACCCAGAGGCATGGTGACCGGTGCGGGAGAGGGCAGGCCAGCTTCAGGGTGCAGACCCCGCAGAAGCCCGGCTTCACTGGCTCCAGGGTTGTTGCAGGGGGG Homo sapiens Chromosome 1 genomic contig, reference assembly NT_004487.18 100%
150-7 CCAGGCAGCCAGGGCGCGGCTGAGGTGGGGTGAGGAGGGAGCGCGGGGCGGGCCGTCCGCCTTGCGTGGGAAGCCGCACCCCCTGCAGATGCCGTGGGCGTTTGTCTCTGCCCCCCCCAGGCACCGGCATCGTCAGCCCAGG Homo sapiens Chromosome 16 genomic contig, reference assembly NT_037887.4 100%
150-8 CCTGTGTGGCCGGAGCCTCCGCGATGAGCACTGCCCCCTGCTCCACGGCACCCAGTCCCATCAACCACCCAAGGGCTGAGGAGTGTGGGCTCATGGCACAGGACTGGCAAGCAGCTCCACCTGCAGCCCCAGTGCAGGATCCACTGGG Homo sapiens Chromosome 7 genomic contig, reference assembly NT_007914.14 86%
300-1 GACCCATCTGGCCGCCTCCCGAGAGGCCATGGGCGCTGTGACTCCTTCATCTTGGCCTAGGAAGCACCAGCCTTCAGCTGCTCACGCCAGATTCTTGCAGACATTGCAACTCCTCTTTTTCTCGGCTCTACCTTCCACAAACATCCCCTGCTACTGCCAGGACCAGGCCCCGGCCCCGATCCCGGCCCGGTCCACCGCAGCCCATCCCCGCACTGGCTCCTTGCTGCCCCCGACCCTCCCAGCAGCCAGAGGGACTTTTCACC Homo sapiens Chromosome 9 genomic contig, reference assembly NT_024000.16 100%
300-2 GATCCCCCTCCCAAGAAGCGCCCGGCCCGGGCCGGCCCAGCGGGAGCACCTGAGCTGTTCTGGGCCTCCAGCGTCCTGTGCCCTGCAGAGGCGGGTCCTAGGGAGGCAGAGCTGAGGTGGGGAGGTGGGGGACAGGTCTAGAGAGGATCAGGCACGGCGCGCCCTCGGCCAAGGGCCCCCACCCCAAACATTTCTCCCTGCTGGTCGGCCTTCTCGTTCCCACTCCGCAGGAACCACTGGAAGACAGGCTTCCGGGGAAAACGGCCTGGGGTTTACAAATAACCCAGGTC Homo sapiens Chromosome 11 genomic contig, alternate assembly NW_001838025.2 100%
300-3 CCACACCTGGATCTGACTGCCCCANNGCCCTTCAGGGCCCTTTGAGGGGGTGATGGGGACAATGTGGAAAGAGGGGGAGGGAAGTTGGGGGGTCCTGCCCACAGCCCCTGCCTGTCTGCACCTCATGTCCCGCACACACACGCTCAGTGCCTGCCCTGAGGAGTGGCAGACCCATTTTACTTTCTTAGAGTAGAGGAGGAAGAGGTGCAGGAGGAAGGCCAGGTAGGAGGGCTGGTAGGGCCAGGGCACTCCCCACCACTGACTGCCCCAGAGGGTGACTTGGG Homo sapiens Chromosome 17 genomic contig, reference assembly NT_010718.15 99%
300-4 AACCAGGCCTCAGGTGCAGGCCCCACATGACAGATGGACAGACTGAAGTGGGAGGTGGGAGGCGGACACCCCGGCGTCCTGCCAGGAAGGGACACCATCTGCACCTGGCGAGCTGTGGCCTCCAGCCATCGTTTCCCTGCCTAGTTAGGGGCTTTTCCCTCCAGAGCCCTGTCCACTCTGGCCTTGTTTCTGGAACTGCTCCTCACCCGGAGGACCCCATCCTTTCCGTGAAGCAGGCAGTGGGGGCTTTCTGGCAAGTGGCCTCTTCATTAACTATCCCAGAGTGAGTGCAGTC Homo sapiens Chromosome 16 genomic contig, reference assembly NT_010498.15 100%